Dihyrofolate Reductase (Mycobacterium tuberculosis)

*Target (protein/gene name):

Dihyrdofolate Reductase Mycobacterium Tuberculosis 1DF7

*NCBI Gene # or RefSeq#:

GI: 581362

*Protein ID (NP or XP #) or Wolbachia#:

1DF7

*Organism (including strain):

Mycobacterium Tuberculosis 1DF7

Etiologic Risk Group (see link below):

Risk Group 3 (RG3)

*Background/Disease Information (sort of like the Intro to your Mini Research Write up):

Tuberculosis is a lethal and infectious disease caused the mycobacteria strain Mycobacterium tuberculosis. Tuberculosis usually affects the lungs, but it can also spread to the rest of the body. It is spread through the air, especially when people cough or sneeze. If tuberculosis is left untreated it could kill more than 50% of those infected.

http://www.tdrtargets.org/targets/view?gene_id=5868

Essentiality of this protein:

It is essential.
http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma/Enzyme_Assay/dihydrofolatereductase.pdf

Complex of proteins?:

no

Druggable Target:

Yes
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC128743/

*EC#:

Link to BRENDA EC# page:

--Show screenshot of BRENDA enzyme mechanism schematic


Figure. 1. BRENDA Enzyme mechanism schematic for Dihydrofolate reductase.

Enzyme Assay information (spectrophotometric, coupled assay ?, reagents):

http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma/Enzyme_Assay/dihydrofolatereductase.pdf

-- link to Sigma (or other company) page for assay or assay reagents (substrates)

http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma/Enzyme_Assay/dihydrofolatereductase.pdf

-- link (or citation) to paper that contains assay information

http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma/Enzyme_Assay/dihydrofolatereductase.pdf

-- List cost and quantity of substrate reagents and supplier

50 mM Potassium Phosphate Buffer, pH 6.5 at 25°C $21.70

0.11 mM ß-Nicotinamide Adenine Dinucleotide Phosphate, Reduced Form Solution (Price not found on sigma)

2.3 mM Dihydrofolic Acid Solution (DHFA) (Price not found on sigma)

0.1% (w/v) Bovine Serum Albumin Solution (BSA) $193.00

Structure Available (PDB or Homology model)

http://www.pdb.org/pdb/explore/explore.do?structureId=1DF7


Current Inhibitors:

Zn2+
Li+
Mg2+

Expression Information (has it been expressed in bacterial cells):

Yes it is expressed in other bacteria cells. One such example is E. Coli.

Purification Method:

Nickel or His tag purification.

Image of protein (PyMol with features delineated and shown separately):


Figure 1. Dihydrofolate Reductase protein shown in cartoon. The orange spirals are helices and the blue arrows are beta sheets.

*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):

MVGLIWAQATSGVIGRGGDIPWRLPEDQAHFREITMGHTIVMGRRTWDSLPAKVRPLPGRRNVVLSRQADFMASGAEVVGSLEEALTSPETWVIGGGQVYALALPYATRCEVTEVDIGLPREAGDALAPVLDETWRGETGEWRFSRSGLRYRLYSYHRS

*length of your protein in Amino Acids

159

Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website:

17640 kiloDaltons

Molar Extinction coefficient of your protein at 280 nm wavelength:

coefficient    40450
Abs 0.1% (=1 g/l)   2.293, assuming all pairs of Cys residues form cystines
 
 
Ext. coefficient    40450
Abs 0.1% (=1 g/l)   2.293, assuming all Cys residues are reduced
 
 

TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it.



*CDS Gene Sequence (paste as text only):

<span style="background-color: #ffffff; font-family: monospace,serif;"><span class="ff_line">ATGGTGGGGCTGATCTGGGCTCAAGCGACATCGGGTGTCATCGGCCGCGGCGGCGACATCCCCTGGCGCT
TGCCCGAGGACCAGGCGCATTTCCGGGAGATCACCATGGGGCACACGATCGTGATGGGCCGGCGCACATG
GGATTCGCTGCCGGCTAAAGTCCGGCCGCTGCCCGGCCGGCGAAATGTCGTACTGAGCCGCCAAGCTGAC
TTTATGGCCAGCGGGGCTGAGGTTGTCGGTTCACTCGAGGAGGCGCTGACCAGCCCGGAGACGTGGGTGA
TCGGAGGCGGACAAGTCTATGCGCTGGCGCTGCCGTACGCGACCAGATGTGAGGTTACCGAGGTCGACAT
CGGCCTGCCGCGCGAAGCCGGTGACGCGCTGGCCCCCGTGCTGGACGAGACATGGCGGGGCGAGACGGGG
GAGTGGCGCTTCAGCCGGTCCGGGTTGCGGTACCGGTTGTACAGCTACCACCGCTCATGA</span></span>

Do Not Need this info for Spring (but still copy these lines to your Target page for now)

Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers):

(link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)

-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.


Primer design results for 'tail' primers (this is just 2 sequences):